D5Mit115 Primer Detail MGI Mouse MGI:700848

D5Mit115 Primer Detail

Name

D5Mit115
Primer 1 Sequence

AGAAAAGCTGTTGCCTGCTC
Primer 2 Sequence

CAAAGCTGAAAGAAACAAAGATATC
ID

MGI:700848
Product Size

144
Other IDs

D5Mit115 (BROAD)
Note

MIT assay: D832
Additional information: MIT STS Marker Data Files

D5Mit115

DNA segment, Chr 5, Massachusetts Institute of Technology 115

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit115	a	130bp	129X1/Sv
Not Specified	D5Mit115	f	130, 144bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit115	a	120bp	CAST/EiJ
	b	130bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, SPRET/EiJ
	c	144bp	C3H/HeJ
	d	154bp	NON/ShiLt

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24