D4Mit310 Primer Detail MGI Mouse MGI:700888

D4Mit310 Primer Detail

Name

D4Mit310
Primer 1 Sequence

TCTCCACGTGTGTGCCTTAG
Primer 2 Sequence

TGAAAGCACTCTGCAGACTCA
ID

MGI:700888
Product Size

117
Other IDs

D4Mit310 (BROAD)
Note

MIT assay: MTH1948
Additional information: MIT STS Marker Data Files

D4Mit310

DNA Segment, Chr 4, Massachusetts Institute of Technology 310

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit310	a	115bp	AKR/J, C3H/HeJ
	b	117bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	121bp	CAST/EiJ, DBA/2J
	d	125bp	SPRET/EiJ
	e	127bp	A/J, BALB/cJ
	f	129bp	NOD/MrkTac, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D4Mit310	a	116bp	AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, JF1
	c	126bp	A/JOlaHsd, BALB/cJ
	d	120bp	DBA/2J
	g	124bp	129P3/J
	l	128bp	SJL/J
	p	132bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24