D6Mit131 Primer Detail MGI Mouse MGI:700895

D6Mit131 Primer Detail

Name

D6Mit131
Primer 1 Sequence

AAATCCACATTCAATACAGGTGG
Primer 2 Sequence

GACACTCATGGTCAACTTCTGG
ID

MGI:700895
Product Size

139
Other IDs

D6Mit131 (BROAD)
Note

MIT assay: MT41
Additional information: MIT STS Marker Data Files

D6Mit131

DNA segment, Chr 6, Massachusetts Institute of Technology 131

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit131	b	larger	C57BL/6J
	D6Mit131	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit131	a	140bp	C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
	b	142bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NON/ShiLt
	c	156bp	A/J
	d	160bp	SPRET/EiJ
	e	166bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24