About   Help   FAQ
D6Mit139 Primer Detail
Primers
  • Name
    D6Mit139
  • Primer 1 Sequence
    ATAGAAGGCGAGAACTAACCCC
  • Primer 2 Sequence
    TGTTTCTGCCCCTGTAGTTG
  • ID
    MGI:700903
  • Product Size
    114
  • Other IDs
    D6Mit139 (BROAD)
  • Note
    MIT assay: MTH223
    Additional information: MIT STS Marker Data Files
Genes
D6Mit139 DNA segment, Chr 6, Massachusetts Institute of Technology 139
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit139 a 101bp CAST/EiJ
b 115bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
c 119bp A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D6Mit139 c 118bp 129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, SJL/J
d 114bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J
j 110bp JF1
p 112bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory