D6Mit139 Primer Detail MGI Mouse MGI:700903

D6Mit139 Primer Detail

Name

D6Mit139
Primer 1 Sequence

ATAGAAGGCGAGAACTAACCCC
Primer 2 Sequence

TGTTTCTGCCCCTGTAGTTG
ID

MGI:700903
Product Size

114
Other IDs

D6Mit139 (BROAD)
Note

MIT assay: MTH223
Additional information: MIT STS Marker Data Files

D6Mit139

DNA segment, Chr 6, Massachusetts Institute of Technology 139

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit139	a	101bp	CAST/EiJ
	b	115bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
	c	119bp	A/J, BALB/cJ, C3H/HeJ, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D6Mit139	c	118bp	129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, SJL/J
	d	114bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J
	j	110bp	JF1
	p	112bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24