D5Mit240 Primer Detail MGI Mouse MGI:700908

D5Mit240 Primer Detail

Name

D5Mit240
Primer 1 Sequence

ATTAATGTCCATGGTAGAATGTGC
Primer 2 Sequence

ATTTCATTTGCACATACATGCC
ID

MGI:700908
Product Size

150
Other IDs

D5Mit240 (BROAD)
Note

MIT assay: MT3205
Additional information: MIT STS Marker Data Files

D5Mit240

DNA segment, Chr 5, Massachusetts Institute of Technology 240

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit240	a	156bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	170bp	129X1/SvJ
		c	156, 162bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit240	a	154bp	AKR/J, LP/J, NOD/MrkTac
	b	156bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	170bp	SPRET/EiJ
	d	172bp	A/J, BALB/cJ, DBA/2J
	e	176bp	C3H/HeJ, NON/ShiLt
	f	178bp	CAST/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D5Mit240	c	smaller	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit240	c	134bp	CBA/CaOlaHsd
	D5Mit240	s	125bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24