D4Mit211 Primer Detail MGI Mouse MGI:700922

D4Mit211 Primer Detail

Name

D4Mit211
Primer 1 Sequence

CAGAAAAAAAAAGAAAAGGACAGG
Primer 2 Sequence

GTTTTGTTCATATTATTTAGTCTGGGC
ID

MGI:700922
Product Size

146
Other IDs

D4Mit211 (BROAD)
Note

MIT assay: MT2679
Additional information: MIT STS Marker Data Files

D4Mit211

DNA segment, Chr 4, Massachusetts Institute of Technology 211

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit211	a	145bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NON/ShiLt
	b	153bp	A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
	c	157bp	AKR/J
	d	161bp	CAST/EiJ
	e	163bp	LP/J
	f	173bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit211	c	138bp	129P3/J, A/JOlaHsd, AKR/OlaHsd, BALB/cJ, PWB, SJL/J
	D4Mit211	d	132bp	C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J, JF1

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24