D7Mit238 Primer Detail MGI Mouse MGI:700928

D7Mit238 Primer Detail

Name

D7Mit238
Primer 1 Sequence

GCATCTGCTTTTCTGCCTCT
Primer 2 Sequence

AGGCACCTGACATTGACCTC
ID

MGI:700928
Product Size

150
Other IDs

D7Mit238 (BROAD)
Note

MIT assay: MTAR110
Additional information: MIT STS Marker Data Files

D7Mit238

DNA segment, Chr 7, Massachusetts Institute of Technology 238

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit238	a	116bp	A/J, BALB/cJ
	b	122bp	SPRET/EiJ
	c	130bp	CAST/EiJ
	d	132bp	C3H/HeJ, LP/J
	e	134bp	DBA/2J
	f	156bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D7Mit238	a	147bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, SJL/J
	c	111bp	A/JOlaHsd, BALB/cJ
	d	125bp	129P3/J, C3H/HeJ, DBA/2J, JF1
	p	131bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24