About   Help   FAQ
D7Mit237 Primer Detail
Primers
  • Name
    D7Mit237
  • Primer 1 Sequence
    CAAGGCAAAGGGAGAGAATG
  • Primer 2 Sequence
    TGAGAAAAGCCTCATTTTATATGTG
  • ID
    MGI:700931
  • Product Size
    124
  • Other IDs
    D7Mit237 (BROAD)
  • Note
    MIT assay: MT3352
    Additional information: MIT STS Marker Data Files
Genes
D7Mit237 DNA segment, Chr 7, Massachusetts Institute of Technology 237
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit237 a 110bp AKR/J, BALB/cJ, NON/ShiLt
b 116bp C3H/HeJ, DBA/2J
c 118bp LP/J
d 120bp CAST/EiJ
e 122bp A/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
f 126bp SPRET/EiJ
J:57749 Hansen GM, et al., Genome Res. 2000 Feb;10(2):237-43
Endonuclease Gene Allele Fragments Strains
D7Mit237 l 0.150kb SB/LeJ
s 0.156kb M. spretus
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57749 Hansen GM, et al., Genetic profile of insertion mutations in mouse leukemias and lymphomas. Genome Res. 2000 Feb;10(2):237-43
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory