About   Help   FAQ
D7Mit232 Primer Detail
Primers
  • Name
    D7Mit232
  • Primer 1 Sequence
    TGTGAGATGAATGCCATGTACA
  • Primer 2 Sequence
    TCCACTTACAGAGATTCAAAACTCC
  • ID
    MGI:700934
  • Product Size
    129
  • Other IDs
    D7Mit232 (BROAD)
  • Note
    MIT assay: MT3305
    Additional information: MIT STS Marker Data Files
Genes
D7Mit232 DNA segment, Chr 7, Massachusetts Institute of Technology 232
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit232 a 94bp CAST/EiJ
b 116bp SPRET/EiJ
c 130bp DBA/2J, LP/J
d 132bp B6.Cg-Lepob/+, C57BL/6J
e 134bp C3H/HeJ
f 136bp NON/ShiLt
g 138bp A/J, AKR/J, BALB/cJ, NOD/MrkTac
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D7Mit232 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit232 c 135bp CBA/CaOlaHsd
s 134bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/12/2024
MGI 6.24 		The Jackson Laboratory