D17Mit31 Primer Detail MGI Mouse MGI:700953

D17Mit31 Primer Detail

Name

D17Mit31
Primer 1 Sequence

TGTTGGAGCTGAATACACGC
Primer 2 Sequence

CCCAAAATTGATCTGGTGCT
ID

MGI:700953
Product Size

139
Other IDs

D17Mit31 (BROAD)
Note

MIT assay: D608
Additional information: MIT STS Marker Data Files

D17Mit31

DNA segment, Chr 17, Massachusetts Institute of Technology 31

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit31	c	140bp	C3HeB/FeJLe
	D17Mit31	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit31	a	140bp	AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
	b	160bp	B6.Cg-Lep^ob/+, C57BL/6J, SPRET/EiJ
	c	162bp	LP/J
	d	166bp	BALB/cJ, CAST/EiJ, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit31	a	166bp	BALB/cW, BN/aW
	b	160bp	129/SvW, C57BL/6W, C57BL/10W, DBA/2W
	c	140bp	A.CA/W, AKR/W, C3H/W, CBA/W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24