About   Help   FAQ
D15Mit136 Primer Detail
Primers
  • Name
    D15Mit136
  • Primer 1 Sequence
    TGAACACAGGTGTTTTAAAATTAAGG
  • Primer 2 Sequence
    TATGTGCTGAGTCATGTATACACACA
  • ID
    MGI:700957
  • Product Size
    143
  • Other IDs
    D15Mit136 (BROAD)
  • Note
    MIT assay: MT2688
    Additional information: MIT STS Marker Data Files
Genes
D15Mit136 DNA segment, Chr 15, Massachusetts Institute of Technology 136
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit136 a 123bp 129X1/Sv
f 128bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit136 a 136bp CAST/EiJ, LP/J
b 144bp A/J, NON/ShiLt
c 146bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
d 150bp BALB/cJ
e 152bp SPRET/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory