D17Mit38 Primer Detail MGI Mouse MGI:700962

D17Mit38 Primer Detail

Name

D17Mit38
Primer 1 Sequence

CCTCTGAGGAGTAACCAAGCC
Primer 2 Sequence

CACAGAGTTCTACCTCCAACCC
ID

MGI:700962
Product Size

109
Other IDs

D17Mit38 (BROAD)
Note

MIT assay: B115
Additional information: MIT STS Marker Data Files

D17Mit38

DNA segment, Chr 17, Massachusetts Institute of Technology 38

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit38	a	110bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	102bp	129X1/SvJ
		c	86, 110bp	CD-1

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit38	a	largest	C57BL/6, JF1, MSM/Ms
Not Specified	D17Mit38	b	smaller	DBA/2

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit38	c	92bp	BALB/cJ
Not Specified	D17Mit38	s	110bp	129X1/SvJ, C57BL/6J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit38	a	80bp	SPRET/EiJ
	b	86bp	A/J, AKR/J
	c	92bp	BALB/cJ, C3H/HeJ, DBA/2J
	d	100bp	CAST/EiJ
	e	110bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit38	a	110bp	129/SvW, BN/aW, C57BL/6W, C57BL/10W
	b	92bp	BALB/cW, C3H/W, CBA/W, DBA/2W
	c	86bp	A.CA/W, AKR/W

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24