D11Mit23 Primer Detail MGI Mouse MGI:700965

D11Mit23 Primer Detail

Name

D11Mit23
Primer 1 Sequence

AAAGCAGAGAAGTCTCACCCCT
Primer 2 Sequence

GCACACAGTCATGCAGCAC
ID

MGI:700965
Product Size

122
Other IDs

D11Mit23 (BROAD)
Note

MIT assay: P11
Additional information: MIT STS Marker Data Files

D11Mit23

DNA segment, Chr 11, Massachusetts Institute of Technology 23

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit23	a	largest	C57BL/6, DBA/2
Not Specified	D11Mit23	b	smaller	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit23	a	120bp	A/J, C3H/HeJ, LP/J
	b	124bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
	c	130bp	DBA/2J, NON/ShiLt
	d	134bp	SPRET/EiJ
	e	140bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit23	l	smaller	LG/J
	D11Mit23	s	larger	SM/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24