About   Help   FAQ
D1Mit36 Primer Detail
Primers
  • Name
    D1Mit36
  • Primer 1 Sequence
    GAGGAATGTAGAGTCCAACCTGG
  • Primer 2 Sequence
    TGAATAGATTAAGAGCCTGGAAGC
  • ID
    MGI:700984
  • Product Size
    173
  • Other IDs
    D1Mit36 (BROAD)
  • Note
    MIT assay: B327
    Additional information: MIT STS Marker Data Files
Genes
D1Mit36 DNA segment, Chr 1, Massachusetts Institute of Technology 36
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D1Mit36 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit36 a 166bp CAST/EiJ
b 170bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, DBA/2J, SPRET/EiJ
c 184bp AKR/J, C3H/HeJ, LP/J
d 192bp A/J, NOD/MrkTac
e 196bp NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D1Mit36 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit36 c 186bp CBA/CaOlaHsd
s 198bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory