D1Mit33 Primer Detail MGI Mouse MGI:700987

D1Mit33 Primer Detail

Name

D1Mit33
Primer 1 Sequence

GGATGGACATGCCCAGAG
Primer 2 Sequence

TCCCATGAAATGAGGTTTTTG
ID

MGI:700987
Product Size

100
Other IDs

D1Mit33 (BROAD)
Note

MIT assay: B192
Additional information: MIT STS Marker Data Files

D1Mit33

DNA segment, Chr 1, Massachusetts Institute of Technology 33

J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D1Mit33	b	0.100kb	B10.BR-H2^k, B10.D2-H2^d, BALB.K-H2^k, C57BL/6
Not Specified	D1Mit33	c	0.124kb	BALB/cAnNCr, BALB/cByJ, BALB/cJ

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit33	c	94bp	C3HeB/FeJLe
	D1Mit33	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit33	a	94bp	AKR/J, C3H/HeJ
	b	96bp	LP/J
	c	100bp	A/J, C57BL/6J, NON/ShiLt
	d	102bp	B6.Cg-Lep^ob/+
	e	104bp	NOD/MrkTac
	f	108bp	SPRET/EiJ
	g	114bp	CAST/EiJ
	h	122bp	DBA/2J
	i	124bp	BALB/cJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D1Mit33	c	larger	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit33	c	121bp	CBA/CaOlaHsd
	D1Mit33	s	120bp	SWR/OlaHsd

J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24