D10Mit86 Primer Detail MGI Mouse MGI:701008

D10Mit86 Primer Detail

Name

D10Mit86
Primer 1 Sequence

TTTGCCTGTAACAAGCCAGA
Primer 2 Sequence

TTGAGGCTATCAGTTTAAAATCCC
ID

MGI:701008
Product Size

148
Other IDs

D10Mit86 (BROAD)
Note

MIT assay: D962
Additional information: MIT STS Marker Data Files

D10Mit86

DNA segment, Chr 10, Massachusetts Institute of Technology 86

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit86	a	144bp	SPRET/EiJ
	b	150bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
	c	152bp	CAST/EiJ
	d	156bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D10Mit86	c	147bp	A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, JF1, SJL/J
	d	153bp	C57BL/6JOlaHsd, C57BL/10, DBA/2J
	g	137bp	129P3/J
	p	145bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24