D4Mit31 Primer Detail MGI Mouse MGI:701009

D4Mit31 Primer Detail

Name

D4Mit31
Primer 1 Sequence

ACGAGTTGTCCTCTGATCAACA
Primer 2 Sequence

AGCCAGAGCAAACACCAACT
ID

MGI:701009
Product Size

121
Other IDs

D4Mit31 (BROAD)
Note

MIT assay: B133
Additional information: MIT STS Marker Data Files

D4Mit31

DNA segment, Chr 4, Massachusetts Institute of Technology 31

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit31	c	112bp	C3HeB/FeJLe
	D4Mit31	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit31	a	104bp	CAST/EiJ
	b	112bp	BALB/cJ, C3H/HeJ, NOD/MrkTac
	c	120bp	AKR/J, DBA/2J
	d	122bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	130bp	A/J, LP/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24