D4Mit91 Primer Detail MGI Mouse MGI:701021

D4Mit91 Primer Detail

Name

D4Mit91
Primer 1 Sequence

ATTCTGACACTAGGGGGCG
Primer 2 Sequence

GTTCTCTTACTTGCCATTTGTGG
ID

MGI:701021
Product Size

236
Other IDs

D4Mit91 (BROAD)
Note

MIT assay: MPC970
Additional information: MIT STS Marker Data Files

D4Mit91

DNA segment, Chr 4, Massachusetts Institute of Technology 91

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit91	a	220bp	AKR/J, CAST/EiJ, NOD/MrkTac
	b	230bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
	c	236bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D4Mit91	a	236bp	129/SvW, C57BL/6W, C57BL/10W
	b	230bp	A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
	c	220bp	AKR/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24