D4Mit99 Primer Detail MGI Mouse MGI:701023

D4Mit99 Primer Detail

Name

D4Mit99
Primer 1 Sequence

TCTAAGAAGATCTAACCTGTGGGC
Primer 2 Sequence

CCCATCACTAGGCACACACC
ID

MGI:701023
Product Size

143
Other IDs

D4Mit99 (BROAD)
Note

MIT assay: MPC1513
Additional information: MIT STS Marker Data Files

D4Mit99

DNA segment, Chr 4, Massachusetts Institute of Technology 99

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D4Mit99	a	144bp	129X1/Sv
Not Specified	D4Mit99	f	136, 144bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit99	a	108bp	CAST/EiJ
	b	136bp	A/J, AKR/J, NOD/MrkTac
	c	144bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J
	d	148bp	BALB/cJ, LP/J, NON/ShiLt

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24