D9Mit150 Primer Detail MGI Mouse MGI:701036

D9Mit150 Primer Detail

Name

D9Mit150
Primer 1 Sequence

GGTTGGTTACATATGCACTGTACC
Primer 2 Sequence

AGCCAAGGCATATCAAAATTAG
ID

MGI:701036
Product Size

112
Other IDs

D9Mit150 (BROAD)
Note

MIT assay: MTH109
Additional information: MIT STS Marker Data Files

D9Mit150

DNA segment, Chr 9, Massachusetts Institute of Technology 150

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Mit150	a	116bp	129P2/Ola, 129P3/J, 129X1/Sv
		b	118bp	129X1/SvJ
		c	116, 118bp	129T1/Sv-Dnd1^Ter
		d	112bp	CD-1

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24