D7Mit301 Primer Detail MGI Mouse MGI:701057

D7Mit301 Primer Detail

Name

D7Mit301
Primer 1 Sequence

CTGTGAAGTATGCTTTCTCTTACACA
Primer 2 Sequence

TGCTTTGCAGATGGCTCTAC
ID

MGI:701057
Product Size

119
Other IDs

D7Mit301 (BROAD)
Note

MIT assay: MTH695
Additional information: MIT STS Marker Data Files

D7Mit301

DNA segment, Chr 7, Massachusetts Institute of Technology 301

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit301	a	101bp	SPRET/EiJ
	b	115bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	125bp	CAST/EiJ, NOD/MrkTac
	d	127bp	DBA/2J
	e	131bp	A/J, AKR/J, BALB/cJ, NON/ShiLt
	f	133bp	LP/J
	g	135bp	C3H/HeJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D7Mit301	a	135bp	A.CA/W, C3H/W, CBA/W
	b	131bp	AKR/W, BALB/cW, BN/aW
	c	127bp	DBA/2W
	d	115bp	129/SvW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24