D15Mit34 Primer Detail MGI Mouse MGI:701066

D15Mit34 Primer Detail

Name

D15Mit34
Primer 1 Sequence

TGGACAACCATTTTGGACAA
Primer 2 Sequence

CTTTCTGTCAGGCATCACCA
ID

MGI:701066
Product Size

147
Other IDs

D15Mit34 (BROAD)
Note

MIT assay: B450
Additional information: MIT STS Marker Data Files

D15Mit34

DNA segment, Chr 15, Massachusetts Institute of Technology 34

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit34	a	124bp	CAST/EiJ, SPRET/EiJ
	b	146bp	NON/ShiLt
	c	148bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac
	d	178bp	DBA/2J
	e	192bp	AKR/J, BALB/cJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit34	l	larger	LG/J
	D15Mit34	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D15Mit34	a	192bp	AKR/W, BALB/cW
	b	178bp	DBA/2W
	c	148bp	129/SvW, A.CA/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24