D16Mit9 Primer Detail MGI Mouse MGI:701077

D16Mit9 Primer Detail

Name

D16Mit9
Primer 1 Sequence

TCTTGCTCTGGTATCAACTACAGG
Primer 2 Sequence

CCTCCTTGCCCAGCTAAAC
ID

MGI:701077
Product Size

143
Other IDs

D16Mit9 (BROAD)
Note

MIT assay: B159
Additional information: MIT STS Marker Data Files

D16Mit9

DNA segment, Chr 16, Massachusetts Institute of Technology 9

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit9	m	166bp	MOLF/EiJ
Not Specified	D16Mit9	s	140bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit9	a	126bp	BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	b	130bp	SPRET/EiJ
	c	134bp	A/J, AKR/J
	d	146bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	152bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D16Mit9	a	142bp	C57BL/6W, C57BL/10W
	b	134bp	A.CA/W, AKR/W
	c	126bp	129/SvW, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24