D15Mit209 Primer Detail MGI Mouse MGI:701135

D15Mit209 Primer Detail

Name

D15Mit209
Primer 1 Sequence

TTGTGCTTCACTAGATGTAGACCA
Primer 2 Sequence

TTTTATAGTTGCACATAAGCAGCA
ID

MGI:701135
Product Size

125
Other IDs

D15Mit209 (BROAD)
Note

MIT assay: MT5139
Additional information: MIT STS Marker Data Files

DNA segment, Chr 15, Massachusetts Institute of Technology 209

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit209	a	104bp	CAST/EiJ
	b	106bp	BALB/cJ, C3H/HeJ
	c	114bp	SPRET/EiJ
	d	121bp	LP/J, NOD/MrkTac
	e	127bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D15Mit209	a	127bp	A.CA/W, AKR/W, C57BL/6W, C57BL/10W, DBA/2W
	b	120bp	129/SvW, BN/aW
	c	106bp	BALB/cW, C3H/W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24