About   Help   FAQ
D11Mit79 Primer Detail
Primers
  • Name
    D11Mit79
  • Primer 1 Sequence
    TTCTTGGTCGTAGCCCTCAC
  • Primer 2 Sequence
    GACACACAACACCTCGCG
  • ID
    MGI:701152
  • Product Size
    150
  • Other IDs
    D11Mit79 (BROAD)
  • Note
    MIT assay: MPC1752
    Additional information: MIT STS Marker Data Files
Genes
D11Mit79 DNA segment, Chr 11, Massachusetts Institute of Technology 79
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit79 a 142bp A/J, AKR/J, BALB/cJ, LP/J, NON/ShiLt
b 146bp C3H/HeJ, DBA/2J, NOD/MrkTac
c 152bp B6.Cg-Lepob/+, C57BL/6J
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D11Mit79 c upper CBA/Kw
k lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory