D10Mit3 Primer Detail MGI Mouse MGI:701261

D10Mit3 Primer Detail

Name

D10Mit3
Primer 1 Sequence

GTTGATAGTCCCACCTCACTCA
Primer 2 Sequence

TGAGAAATTCCATCTGTGGC
ID

MGI:701261
Product Size

244
Other IDs

D10Mit3 (BROAD)
Note

MIT assay: A114
Additional information: MIT STS Marker Data Files

D10Mit3

DNA segment, Chr 10, Massachusetts Institute of Technology 3

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D10Mit3	b	largest	C57BL/6J
	c	215bp	C3HeB/FeJLe
	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit3	a	205bp	SPRET/EiJ
	b	210bp	CAST/EiJ
	c	215bp	AKR/J, C3H/HeJ, DBA/2J
	d	245bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D10Mit3	a	260bp	129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W
	b	225bp	AKR/W, BN/aW
	c	210bp	C3H/W, CBA/W, DBA/2W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit3	c	upper	CBA/Kw
	D10Mit3	e	lower	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/25/2025 MGI 6.24