About   Help   FAQ
DXMit68 Primer Detail
Primers
  • Name
    DXMit68
  • Primer 1 Sequence
    TCCTTTGGCCTCCTGCATAT
  • Primer 2 Sequence
    TGTTCTTACAATGAGCCTCATAGG
  • ID
    MGI:701266
  • Product Size
    128
  • Other IDs
    DXMit68 (BROAD)
  • Note
    MIT assay: MT306
    Additional information: MIT STS Marker Data Files
Genes
DXMit68 DNA segment, Chr X, Massachusetts Institute of Technology 68
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit68 a 121bp A/J, BALB/cJ, C3H/HeJ, DBA/2J
b 123bp CAST/EiJ
c 129bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
d 131bp SPRET/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
DXMit68 a 129bp 129/SvW, AKR/W, BN/aW, C57BL/6W, C57BL/10W
b 121bp A.CA/W, BALB/cW, C3H/W, CBA/W, DBA/2W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
DXMit68 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory