About   Help   FAQ
DXMit64 Primer Detail
Primers
  • Name
    DXMit64
  • Primer 1 Sequence
    GGATCAGTTAGCAGGGAAAGG
  • Primer 2 Sequence
    CACAGACTGAGAAGGCTGTCC
  • ID
    MGI:701270
  • Product Size
    130
  • Other IDs
    DXMit64 (BROAD)
  • Note
    MIT assay: D845
    Additional information: MIT STS Marker Data Files
Genes
DXMit64 DNA segment, Chr X, Massachusetts Institute of Technology 64
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit64 a 114bp 129X1/Sv
f 134bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit64 a 114bp A/J, BALB/cJ, C3H/HeJ, LP/J
b 130bp CAST/EiJ
c 132bp SPRET/EiJ
d 133bp AKR/J, DBA/2J, NOD/MrkTac
e 134bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
DXMit64 c 207bp CBA/CaOlaHsd
s 202bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory