D5Mit208 Primer Detail MGI Mouse MGI:701278

D5Mit208 Primer Detail

Name

D5Mit208
Primer 1 Sequence

TGAACAGTTTGTTCCCTCCC
Primer 2 Sequence

TAATCACATGGCTTCTGGCA
ID

MGI:701278
Product Size

127
Other IDs

D5Mit208 (BROAD)
Note

MIT assay: MT2300
Additional information: MIT STS Marker Data Files

D5Mit208

DNA segment, Chr 5, Massachusetts Institute of Technology 208

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit208	a	129bp	129X1/Sv
Not Specified	D5Mit208	f	117bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit208	a	96bp	SPRET/EiJ
	b	117bp	AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
	c	120bp	A/J
	d	129bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	e	131bp	LP/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13