About   Help   FAQ
D13Mit17 Primer Detail
Primers
  • Name
    D13Mit17
  • Primer 1 Sequence
    CACCCCCAAGTTCTCTTGAA
  • Primer 2 Sequence
    CCCACATACACATGTGCACA
  • ID
    MGI:701296
  • Product Size
    151
  • Other IDs
    D13Mit17 (BROAD)
  • Note
    MIT assay: D541
    Additional information: MIT STS Marker Data Files
Genes
D13Mit17 DNA segment, Chr 13, Massachusetts Institute of Technology 17
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D13Mit17 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit17 a 136bp CAST/EiJ
b 154bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 172bp B6.Cg-Lepob/+, C57BL/6J
d 320bp SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory