D13Mit17 Primer Detail MGI Mouse MGI:701296

D13Mit17 Primer Detail

Name

D13Mit17
Primer 1 Sequence

CACCCCCAAGTTCTCTTGAA
Primer 2 Sequence

CCCACATACACATGTGCACA
ID

MGI:701296
Product Size

151
Other IDs

D13Mit17 (BROAD)
Note

MIT assay: D541
Additional information: MIT STS Marker Data Files

D13Mit17

DNA segment, Chr 13, Massachusetts Institute of Technology 17

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit17	b	larger	C57BL/6J
	D13Mit17	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit17	a	136bp	CAST/EiJ
	b	154bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	172bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	320bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24