D13Mit11 Primer Detail MGI Mouse MGI:701299

D13Mit11 Primer Detail

Name

D13Mit11
Primer 1 Sequence

CATGGCTCCTTTAACCTGTTT
Primer 2 Sequence

CAATGATTAACCCTTGAAAAAACA
ID

MGI:701299
Product Size

147
Other IDs

D13Mit11 (BROAD)
Note

MIT assay: A91
Additional information: MIT STS Marker Data Files

D13Mit11

DNA segment, Chr 13, Massachusetts Institute of Technology 11

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit11	b	smaller	C57BL/6J
	D13Mit11	f	larger	FVB/N

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit11	m	160bp	MOLF/EiJ
Not Specified	D13Mit11	s	175bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit11	a	145bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	155bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
	c	159bp	NOD/MrkTac
	d	160bp	CAST/EiJ, LP/J, SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24