D19Mit20 Primer Detail MGI Mouse MGI:701329

D19Mit20 Primer Detail

Name

D19Mit20
Primer 1 Sequence

AAGCAGGGGTGTGTCAGC
Primer 2 Sequence

CTTGTCACCCTCTCCAGAGC
ID

MGI:701329
Product Size

224
Other IDs

D19Mit20 (BROAD)
Note

MIT assay: A1120
Additional information: MIT STS Marker Data Files

D19Mit20

DNA segment, Chr 19, Massachusetts Institute of Technology 20

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit20	m	183bp	MOLF/EiJ
Not Specified	D19Mit20	s	229bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit20	a	156bp	CAST/EiJ
	b	174bp	SPRET/EiJ
	c	220bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13