D1Mit201 Primer Detail MGI Mouse MGI:701348

D1Mit201 Primer Detail

Name

D1Mit201
Primer 1 Sequence

ATAATTGGATAAGAAAAAACACACACA
Primer 2 Sequence

CACCCACTTTGATGCAAATG
ID

MGI:701348
Product Size

120
Other IDs

D1Mit201 (BROAD)
Note

MIT assay: MT910
Additional information: MIT STS Marker Data Files

D1Mit201

DNA segment, Chr 1, Massachusetts Institute of Technology 201

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit201	c	121bp	C3HeB/FeJLe
	D1Mit201	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit201	a	100bp	SPRET/EiJ
	b	121bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	c	133bp	LP/J
	d	137bp	CAST/EiJ, DBA/2J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24