D1Mit200 Primer Detail MGI Mouse MGI:701349

D1Mit200 Primer Detail

Name

D1Mit200
Primer 1 Sequence

GCCATGTTCATGTACATAGGTAGG
Primer 2 Sequence

ATGGATGGATGGTTTTCCTG
ID

MGI:701349
Product Size

199
Other IDs

D1Mit200 (BROAD)
Note

MIT assay: D1212
Additional information: MIT STS Marker Data Files

D1Mit200

DNA segment, Chr 1, Massachusetts Institute of Technology 200

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit200	a	205bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
	b	238bp	NON/ShiLt
	c	242bp	LP/J
	d	255bp	AKR/J
	e	275bp	DBA/2J
	f	297bp	A/J, C3H/HeJ
	g	301bp	CAST/EiJ
	h	530bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D1Mit200	a	310bp	BN/aW
	b	297bp	A.CA/W
	c	275bp	C3H/W, CBA/W, DBA/2W
	d	255bp	AKR/W
	e	205bp	129/SvW, BALB/cW, C57BL/6W, C57BL/10W

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit200	c	upper	CBA/Kw
	D1Mit200	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24