D1Mit202 Primer Detail MGI Mouse MGI:701351

D1Mit202 Primer Detail

Name

D1Mit202
Primer 1 Sequence

CCATAAGCCTCCTCTTTCCC
Primer 2 Sequence

AAAATGAACTCAGCGGGTTG
ID

MGI:701351
Product Size

143
Other IDs

D1Mit202 (BROAD)
Note

MIT assay: MT1081
Additional information: MIT STS Marker Data Files

D1Mit202

DNA segment, Chr 1, Massachusetts Institute of Technology 202

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit202	a	125bp	AKR/J, C3H/HeJ, LP/J, NOD/MrkTac
	b	143bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	185bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D1Mit202	a	155bp	A.CA/W
	b	143bp	129/SvW, C57BL/6W, C57BL/10W
	c	125bp	AKR/W, C3H/W, CBA/W
	d	100bp	BALB/cW, BN/aW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24