DXMit124 Primer Detail MGI Mouse MGI:701367

DXMit124 Primer Detail

Name

DXMit124
Primer 1 Sequence

AAGGAGAAGTAGAAGAAAGAAAAGAGG
Primer 2 Sequence

GGTGTAGCCTCAAAAAAGATGG
ID

MGI:701367
Product Size

169
Other IDs

DXMit124 (BROAD)
Note

MIT assay: MT3306
Additional information: MIT STS Marker Data Files

DXMit124a	DNA segment, Chr X, Massachusetts Institute of Technology 124a
DXMit124b	DNA segment, Chr X, Massachusetts Institute of Technology 124b

J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit124a	b	0.130kb	B10.BR-H2^k, C57BL/6
Not Specified	DXMit124a	c	0.176kb	B10.D2-H2^d, BALB/cAnNCr, BALB/cByJ, BALB/cJ

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit124a	c	174bp	C3HeB/FeJLe
	DXMit124a	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit124a	a	160bp	CAST/EiJ
	b	174bp	C3H/HeJ, DBA/2J
	c	176bp	A/J, AKR/J, BALB/cJ, LP/J
	d	178bp	NON/ShiLt
	e	180bp	C57BL/6J, NOD/MrkTac
	f	182bp	B6.Cg-Lep^ob/+
	g	200bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit124a	c	174bp	CBA/CaOlaHsd
	DXMit124a	s	168bp	SWR/OlaHsd

J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24