About   Help   FAQ
D13Mit191 Primer Detail
Primers
  • Name
    D13Mit191
  • Primer 1 Sequence
    GCAAATTAGAGAATCATGCATCC
  • Primer 2 Sequence
    TGGAGAATGCTAAAAGCATGG
  • ID
    MGI:701386
  • Product Size
    119
  • Other IDs
    D13Mit191 (BROAD)
  • Note
    MIT assay: MT2546
    Additional information: MIT STS Marker Data Files
Genes
D13Mit191 DNA segment, Chr 13, Massachusetts Institute of Technology 191
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit191 a 122bp B6.Cg-Lepob/+, C57BL/6J
b 124bp A/J
c 126bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
d 130bp LP/J, NOD/MrkTac
e 140bp SPRET/EiJ
f 144bp NON/ShiLt
g 148bp CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D13Mit191 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D13Mit191 c 124bp CBA/CaOlaHsd
s 138bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory