About   Help   FAQ
D13Mit193 Primer Detail
Primers
  • Name
    D13Mit193
  • Primer 1 Sequence
    ACTGCCCATTCATGTGTGTG
  • Primer 2 Sequence
    AGGAAGAAAAATTAGAAGAGAAAAAAA
  • ID
    MGI:701388
  • Product Size
    122
  • Other IDs
    D13Mit193 (BROAD)
  • Note
    MIT assay: MT2492
    Additional information: MIT STS Marker Data Files
Genes
D13Mit193 DNA segment, Chr 13, Massachusetts Institute of Technology 193
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit193 a 114bp 129X1/Sv
f 104, 114, 118bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit193 a 100bp AKR/J
b 104bp A/J, NOD/MrkTac
c 114bp C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
d 122bp CAST/EiJ
e 124bp BALB/cJ
f 126bp B6.Cg-Lepob/+, C57BL/6J
g 130bp SPRET/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory