D17Mit72 Primer Detail MGI Mouse MGI:701410

D17Mit72 Primer Detail

Name

D17Mit72
Primer 1 Sequence

GGCTTGGCGACATTCTAATC
Primer 2 Sequence

CAGCAAATTAACTTTCCCATCA
ID

MGI:701410
Product Size

193
Other IDs

D17Mit72 (BROAD)
Note

MIT assay: MPC2074
Additional information: MIT STS Marker Data Files

D17Mit72

DNA segment, Chr 17, Massachusetts Institute of Technology 72

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit72	a	190bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv, CD-1
Not Specified	D17Mit72	b	202bp	129X1/SvJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit72	a	164bp	CAST/EiJ
	b	176bp	SPRET/EiJ
	c	186bp	AKR/J
	d	188bp	NON/ShiLt
	e	190bp	C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
	f	194bp	B6.Cg-Lep^ob/+, C57BL/6J
	g	204bp	BALB/cJ
	h	206bp	A/J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D17Mit72	a	184bp	AKR/OlaHsd
	b	190bp	C57BL/6JOlaHsd
	c	196bp	BALB/cJ
	d	188bp	129P3/J, C3H/HeJ, DBA/2J, SJL/J
	j	192bp	C57BL/10, JF1
	p	194bp	PWB
	w	200bp	A/JOlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24