D11Mit206 Primer Detail MGI Mouse MGI:701420

D11Mit206 Primer Detail

Name

D11Mit206
Primer 1 Sequence

AAACTTGTCTACGTTATTTGTTGCC
Primer 2 Sequence

TGTCTGTCTTACTGCTGGTTTTG
ID

MGI:701420
Product Size

145
Other IDs

D11Mit206 (BROAD)
Note

MIT assay: MT2089
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 206

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit206	a	153bp	129X1/Sv
Not Specified	D11Mit206	f	149bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit206	a	139bp	SPRET/EiJ
	b	143bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	149bp	NOD/MrkTac, NON/ShiLt
	d	153bp	AKR/J, DBA/2J
	e	157bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	f	159bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24