D9Mit115 Primer Detail MGI Mouse MGI:701431

D9Mit115 Primer Detail

Name

D9Mit115
Primer 1 Sequence

TCCAGACTCCTGGGAACTACA
Primer 2 Sequence

TTTCCCAGCCAGTAAAGGC
ID

MGI:701431
Product Size

145
Other IDs

D9Mit115 (BROAD)
Note

MIT assay: MPC2343
Additional information: MIT STS Marker Data Files

D9Mit115

DNA segment, Chr 9, Massachusetts Institute of Technology 115

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit115	a	137bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	b	139bp	CAST/EiJ
	c	145bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	157bp	AKR/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D9Mit115	a	157bp	AKR/W
	b	145bp	C57BL/6W, C57BL/10W
	c	139bp	A.CA/W, BN/aW
	d	137bp	129/SvW, BALB/cW, C3H/W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24