About   Help   FAQ
D3Mit194 Primer Detail
Primers
  • Name
    D3Mit194
  • Primer 1 Sequence
    GTTTTTGTGATGTTACATACTGGACC
  • Primer 2 Sequence
    ACAACTCATCCCCCTCCTCT
  • ID
    MGI:701452
  • Product Size
    143
  • Other IDs
    D3Mit194 (BROAD)
  • Note
    MIT assay: MT1780
    Additional information: MIT STS Marker Data Files
Genes
D3Mit194 DNA segment, Chr 3, Massachusetts Institute of Technology 194
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit194 a 142bp DBA/2J, LP/J, NON/ShiLt
b 144bp A/J, BALB/cJ, C3H/HeJ
c 146bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
d 150bp NOD/MrkTac
e 156bp CAST/EiJ, SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D3Mit194 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit194 c 158bp CBA/CaOlaHsd
s 163bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory