D18Mit202 Primer Detail MGI Mouse MGI:701499

D18Mit202 Primer Detail

Name

D18Mit202
Primer 1 Sequence

CCCCTTGCAAAGATGGAGTA
Primer 2 Sequence

CATTTGCTAGTTTAGCAGGAAGC
ID

MGI:701499
Product Size

111
Other IDs

D18Mit202 (BROAD)
Note

MIT assay: MTH1344
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 18, Massachusetts Institute of Technology 202

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit202	a	111bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	133bp	A/J, AKR/J, LP/J
	c	135bp	NOD/MrkTac
	d	137bp	NON/ShiLt
	e	143bp	BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J
	f	145bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D18Mit202	a	143bp	C3H/W, CBA/W, DBA/2W
	b	133bp	A.CA/W, AKR/W, BALB/cW
	c	122bp	BN/aW
	d	111bp	129/SvW, C57BL/6W, C57BL/10W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D18Mit202	c	larger	CBA/Kw
	D18Mit202	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24