D14Mit4 Primer Detail MGI Mouse MGI:701510

D14Mit4 Primer Detail

Name

D14Mit4
Primer 1 Sequence

AGGCACCCCCTCACAGTAC
Primer 2 Sequence

TTCATTCCTCCTGCTGACCT
ID

MGI:701510
Product Size

196
Other IDs

D14Mit4 (BROAD)
Note

MIT assay: M228
Additional information: MIT STS Marker Data Files

D14Mit4

DNA segment, Chr 14, Massachusetts Institute of Technology 4

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit4	a	largest	C57BL/6, DBA/2, JF1
Not Specified	D14Mit4	b	smaller	MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit4	a	186bp	SPRET/EiJ
	b	194bp	DBA/2J
	c	196bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NON/ShiLt
	d	198bp	LP/J
	e	200bp	CAST/EiJ, NOD/MrkTac

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit4	l	larger	LG/J
	D14Mit4	s	smaller	SM/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24