D17Mit147 Primer Detail MGI Mouse MGI:701519

D17Mit147 Primer Detail

Name

D17Mit147
Primer 1 Sequence

CAATATGACATTTTGTGGAAATCC
Primer 2 Sequence

TACTAGTGTGCACACGCATGC
ID

MGI:701519
Product Size

127
Other IDs

D17Mit147 (BROAD)
Note

MIT assay: MT2726
Additional information: MIT STS Marker Data Files

D17Mit147a	DNA segment, Chr 17, Massachusetts Institute of Technology 147a
D17Mit147b	DNA segment, Chr 17, Massachusetts Institute of Technology 147b

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Gene	Allele	Fragments	Strains
D17Mit147a	a	smaller	STOCK t¹²
	b	large	STOCK t^w5, STOCK t^w12
	c	larger	C3H

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit147a	a	116bp	C57BL/6J
	b	118bp	CAST/EiJ
	c	126bp	NON/ShiLt
	d	128bp	B6.Cg-Lep^ob/+, C3H/HeJ
	e	130bp	DBA/2J, LP/J, NOD/MrkTac
	f	132bp	A/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit147a	c	120bp	CBA/CaOlaHsd
	D17Mit147a	s	122bp	SWR/OlaHsd

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24