D17Mit148 Primer Detail MGI Mouse MGI:701527

D17Mit148 Primer Detail

Name

D17Mit148
Primer 1 Sequence

CTTTGCCCTTCCAACCTACA
Primer 2 Sequence

TCCATGATGAGATGTTTTCTATGC
ID

MGI:701527
Product Size

93
Other IDs

D17Mit148 (BROAD)
Note

MIT assay: MT1384
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 148

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit148	b	large	STOCK t¹², STOCK t^w5, STOCK t^w12
Not Specified	D17Mit148	c	smallest	C3H

J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit148	a	small	B10.CAS3, B10.CAS4
		b	medium	C3H/HeJ
		c	large	C3.SW-H2^b, C57BL/6, C57BL/10

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit148	a	smallest	A.CA-H2^f/Sn
		b	larger	CBA/J
		c	larger than above	M. caroli
		d	larger than above	C57BL/6J, P/J, SM/J, SWR/J
		e	larger than above	SJL/J
		f	larger than above	DBA/2J, M. spretus
		g	larger than above	RIIIS/J
		h	larger than above	CAST/EiJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit148	a	82bp	AKR/J, C3H/HeJ
	b	94bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	c	96bp	A/J
	d	98bp	BALB/cJ, DBA/2J, SPRET/EiJ
	e	104bp	CAST/EiJ

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24