About   Help   FAQ
D1Mit16 Primer Detail
Primers
  • Name
    D1Mit16
  • Primer 1 Sequence
    AGAGTTAGCTGCCTAGCTTGAGTG
  • Primer 2 Sequence
    TGGAAAGATCTAGGGTTGTCAAAA
  • ID
    MGI:701532
  • Product Size
    186
  • Note
    MIT assay: L46
Genes
D1Mit16 DNA segment, Chr 1, Massachusetts Institute of Technology 16
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit16 a 186bp 129X1/Sv
f 181, 186bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit16 a 162bp NON/ShiLt
b 181bp A/J, CAST/EiJ, NOD/MrkTac
c 186bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J
d 191bp SPRET/EiJ
e 197bp DBA/2J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit16 c 186bp CBA/CaOlaHsd
s 165bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/03/2024
MGI 6.24
The Jackson Laboratory