About   Help   FAQ
D1Mit19 Primer Detail
Primers
  • Name
    D1Mit19
  • Primer 1 Sequence
    GATCCCAGCCAATAGAAGTACA
  • Primer 2 Sequence
    GAAAGGTTTCCTATCCTATGGC
  • ID
    MGI:701533
  • Product Size
    156
  • Other IDs
    D1Mit19 (BROAD)
  • Note
    MIT assay: L86
    Additional information: MIT STS Marker Data Files
Genes
D1Mit19 DNA segment, Chr 1, Massachusetts Institute of Technology 19
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D1Mit19 c 121 C3HeB/FeJLe
f larger FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit19 m 156bp MOLF/EiJ
s 170bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit19 a 100bp LP/J
b 106bp NOD/MrkTac
c 112bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NON/ShiLt
d 119bp DBA/2J
e 121bp A/J, C3H/HeJ
f 123bp SPRET/EiJ
g 150bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D1Mit19 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit19 c 129bp CBA/CaOlaHsd
s 135bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
06/12/2024
MGI 6.13 		The Jackson Laboratory