D14Mit257 Primer Detail MGI Mouse MGI:701542

D14Mit257 Primer Detail

Name

D14Mit257
Primer 1 Sequence

TTGTATAGGCATGTGCTCACG
Primer 2 Sequence

TTTAAAATGATGAGTGTCTTTGCC
ID

MGI:701542
Product Size

93
Other IDs

D14Mit257 (BROAD)
Note

MIT assay: MTH2905
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 14 Massachusetts Institute of Technology 257

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit257	a	96bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	100bp	CAST/EiJ, NOD/MrkTac
	c	104bp	AKR/J
	d	106bp	DBA/2J
	e	108bp	A/J, BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D14Mit257	b	92bp	C57BL/6JOlaHsd, C57BL/10
	c	106bp	129P3/J, A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, PWB
	d	104bp	DBA/2J
	j	112bp	JF1
	l	98bp	SJL/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24