D15Mit244 Primer Detail MGI Mouse MGI:701562

D15Mit244 Primer Detail

Name

D15Mit244
Primer 1 Sequence

TCTACCCTCTGTGGAACATCG
Primer 2 Sequence

CTTTGTGTCCATACACTAATATCAAGG
ID

MGI:701562
Product Size

116
Other IDs

D15Mit244 (BROAD)
Note

MIT assay: MTH2039
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 15, Massachusetts Institute of Technology 244

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit244	b	smaller	C57BL/6J
	D15Mit244	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit244	a	84bp	SPRET/EiJ
	b	102bp	CAST/EiJ
	c	122bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	d	126bp	A/J, AKR/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24